Introduction
Rehmannia
glutinosa is one of the
most famous medicinal herbs with a long cultivation history in China. It has
multiple functions, such as immune regulation, anti-aging, anti-tumor and blood
sugar reduction effects (Fan et al. 2012; Zhang et al. 2013).
However, consecutive monoculture problems are widespread in R. glutinosa
production, which leading to yield reduction, quality deterioration, poor
growth status, and disease aggravation (Zhang et al. 2010; Chen et al.
2018). Notably, these effects affect only R.
glutinosa and can persist for 8–10 years before R. glutinosa can be
replanted (Gu et al. 2013; Zhang et al. 2013). Much research has
focused on the dose-effect relationship in the “plant-microbial-soil” system at
different levels, and it is believed that microecological imbalance mediated by
allelopathic substances may be the main cause of the consecutive monoculture
problem (Zhang et al. 2010; Li et al. 2016; Zhang et al.
2016). According to the recent research, plant immune system abnormalities are
the initial characterization of rhizosphere microecological imbalance (Chen et
al. 2018, 2019; Xie et al. 2019), while mitogen-activated protein
kinase (MAPK) cascades play an important role in this process (Yang et al.
2015; Tian et al. 2017). However, the MAPK cascades and their
involvement in immune responses to consecutive monoculture stress in R.
glutinosa remain unclear.
The MAPK cascades have a highly conserved three-level
cascade response mode, including Mitogen-activated protein kinase kinase kinase
(MAPKKK), Mitogen-activated protein kinase kinase (MAPKK) and MAPK, which play
a crucial role in the growth and development of plants and the signal
transduction of various biotic and abiotic factor stress responses (Asai et
al. 2002; Wang et al. 2018), such as cell division (Jiménez et al.
2007), growth and development (Xu and Zhang 2015), hormone response (Tena et
al. 2001), pathogen infection (Pitzschke et al. 2009), drought, salt
stress (Suarez and Fernandez 2010) and ultraviolet radiation (Galletti et al.
2011). During a eukaryote nuclear reaction, MAPK cascades work as a common
signal transduction pathway and connect different receptors or sensors (Tena et
al. 2001). Therefore, to further study how the MAPK cascades are involved
in the immune response to consecutive monoculture stress, we systematically
analyzed the MAPK cascade families by searching the protein library (Li et
al. 2017), which were constructed by the colleagues and the differential
expression patterns of the coding genes under consecutive monoculture stress.
This research provides an important data-based foundation and theoretical basis
to further understand how the immune mechanism of R. glutinosa’s
responds to consecutive monoculture stress.
Materials and
Methods
Identification
of R. glutinosa MAPK cascade family proteins
First, the
known Arabidopsis MAPK cascade family proteins were obtained from a
public database (https://www.arabidopsis.org/).
Feature extraction and model construction of these MAPKs, MAPKKs and MAPKKKs sequences were carried out
through a Hidden Markov Model-based method. Subsequently, the protein sequences
of putative MAPK cascades in R. glutinosa were extracted from the R.
glutinosa protein library (Li et al. 2017) by the constructed model.
Finally, candidate MAPK cascade family proteins were annotated and further
screened by Blast2GO software to obtain candidate RgMAPKs, RgMAPKKs, and RgMAPKKKs.
Analysis of
physicochemical properties of R. glutinosa MAPK cascade family proteins
The
ProtParam (https://web.expasy.org/protparam) online tool was used to predict
the sequence length, protein molecular weight and
isoelectric point, instability index, and aliphatic index of RgMAPKs, RgMAPKKs and RgMAPKKKs.
Analysis of
structure and conserved domain of R. glutinosa MAPK cascade family
proteins
Phylogenetic
trees of RgMAPKs, RgMAPKKs and RgMAPKKKs were constructed by molecular evolutionary genetics
analysis (MEGA6.06) software using a neighbor-joining method with 1000
bootstrap replicates. At the same time, the multiple comparisons of MAPK
cascade protein sequences corresponding to R. glutinosa and Arabidopsis
were carried out using Clustalx 2.1. In addition, the conserved domains of RgMAPKs and RgMAPKKs were analyzed using the MEME online tool (https://meme-suite.org).
Test setup
and collection of plant materials
The field
experiments for this study were arranged at the Wenxian Agricultural Institute
in Jiaozuo City, Henan Province, China. The field experiments were divided into
two groups. One group was the first year to plant with R. glutinosa in
the fields (FP). The other group was continuous planting of R. glutinosa
in the field the second year (SP). Sowing time for both groups was April 25,
harvested on November 28, 2017. R. glutinosa planted in both groups was
1000 plants, with row spacing of 30 cm × 30 cm. We collected fresh tuber roots
under 40, 60, 80, 100 and 120 days after planting (DAP), which were transferred
into liquid nitrogen and stored at a refrigerator at -80°C until use. Three
biological replicates were collected for all samples.
Measurement
of root activity and the physiological index
To
determine the activities of superoxide dismutase, peroxidase, catalase, and the
contents of malondialdehyde, we used the corresponding kit (Nanjing Jiancheng
Bioengineering Institute) to obtain their respective absorbances (Gu et al.
2018). Meanwhile, measurement of root activity and the hydrogen peroxide
content were conducted per the methodology described by (Chen et al.
2019). Finally, the root activity and the hydrogen peroxide content were
calculated from the absorbance values measured at 415 nm and 390 nm,
respectively.
Analysis of
genes encoding MAPK cascades family proteins by qRT-PCR
Based on
the identification and annotation of RgMAPKs,
RgMAPKKs and RgMAPKKKs, the expression patterns of these genes at the FP and the
SP R. glutinosa (40, 60, 80, 100 and 120 DAP) were analyzed. This study
used the Prime Script RT Reagent Kit (Takara, Japan) to extract total RNA (1 μg)
from each sample and synthesize the cDNA. SYBR Premix Ex Taq (Takara, Japan)
was used to conduct the Quantitative real-time PCR (qRT-PCR). 18S was selected
to normalize the expression of the validated genes (Li et al. 2017).
Three biological replicates were performed. Primer pairs are listed in Table 1.
Results
Identification
of R. glutinosa MAPK cascade family proteins
In order to extract the conservative characteristics of the MAPK
cascade family proteins to train Hidden Markov Model for downstream
identification of MAPK in R. glutinosa, we obtained 110 Arabidopsis
MAPK cascade Table 1: qRT-PCR primers used in validating genes and internal
references
Gene
name |
Forward |
Reverse |
|
MAPKs |
RgMAPK1 |
TCAACACGGACATAATACAC |
ACATCTCTGCTCCTTCAT |
RgMAPK2 |
GAATGAAGGAGCAGAGATG |
GTGTAGAAGGAGCAGACTA |
|
RgMAPK3 |
CTCGAAGCAACTGATACAA |
TTGATGGAGACAGACCTT |
|
RgMAPK4 |
ATGAAGGAGCAGAGATGT |
GTGTATTGGTGTAGAAGGAG |
|
RgMAPK5 |
CCATTACCGTAGTACCTCTA |
GTCACAAGCATACACAGAT |
|
RgMAPK6 |
AAGGTGGAAGCATTATATGTT |
GGTAGTTATGGTGTTGTAGG |
|
RgMAPK7 |
GTGTTGCTCATTGTCATTAC |
AAGAAGGTCCGAAGAGAA |
|
RgMAPK8 |
GCTGATGCTGACTGTAAG |
GTCCAAGATATTGCTGATGA |
|
RgMAPK9 |
TGGTGAAGGAAGTAGATATAGA |
GACGAAGAAGCCTAAGAAG |
|
RgMAPK10 |
GAATATGGTGAAGGAAGTAGAT |
TGACGAAGAAGCCTAAGA |
|
RgMAPK11 |
CTCAGAGACAACATTCATCA |
GCCATAGGAAGTATAGAAGAC |
|
RgMAPK12 |
TATCTTCCTCGCCTTCAT |
GCAACAACAGCATCAATAG |
|
RgMAPK13 |
CTCAATACGGTGGTCAAG |
CTAATACATCCTCGCCATAC |
|
RgMAPK14 |
CCTATGACCTCCTGGATT |
GGCTGCTGTTGATATTGA |
|
RgMAPK15 |
CAATTCCACTGTAATCTCCA |
CGTTCACAAGTTCATCTCT |
|
RgMAPK16 |
CAATCTCGGTTTCCATTCTA |
CATCCTTCCTTCTCAATACAT |
|
RgMAPK17 |
TTCTGTGATTCCTAGTGGTA |
GTGCTCGTCATTACATAGAT |
|
RgMAPK18 |
ATTGTGCGAGTCATCTTC |
AGCAGGCATAATGAATAGTC |
|
RgMAPK19 |
TATTCCTGTCAGCACTCA |
GAACAACAACCTCACCAA |
|
RgMAPK20 |
TATTCCTGTCAGCACTCA |
TTCCTCCACAATCTATCTCT |
|
RgMAPK21 |
CAGTTGGCGTTAATGAGTA |
TAAGAGGTCTGAAGTATCTACA |
|
RgMAPK22 |
GCTTGATTGGCACATACT |
CTGAATGGAAGACGAAGAG |
|
RgMAPK23 |
CTCTGCTGTGATAACTACG |
GCTACCAAGGATGTTGATAA |
|
RgMAPK24 |
TTCAGTTACACCGATCCT |
CATTCAGTCTCTTCCGTATT |
|
RgMAPK25 |
GCTGTGAGGACTTAATAATCT |
GTTATGATGCCGACCAAT |
|
RgMAPK26 |
TCGCTCTCAAGGATGTTA |
AAGAATGTTGGCAGAATGTA |
|
RgMAPK27 |
TTAGCACCACACTACTCA |
CGAAGAACAGATGAAGGAG |
|
RgMAPK28 |
GCACCTTCCACTGTAATC |
ACATCCGACAACTTCCTA |
|
RgMAPK29 |
ACGATTCATCCAATACAACA |
GTCCTCTTCGCATCAATT |
|
RgMAPK30 |
GTTATGAACACGGAGACAA |
CTTAATGGAGGAGGAATCAC |
|
RgMAPK31 |
TTATTGTTGCCGCTATTAGTA |
ATCTCAAGAAGTCTGTAGGA |
|
RgMAPK32 |
ATATGAGTTGATGGATACTGATT |
CAGGCGGAATGTATGTATT |
|
RgMAPK33 |
TTCAGGTTCAAGCAAGTC |
GCAATCTCCTCATTAGTCTC |
|
RgMAPK34 |
GCAAGACATTAGCGGAAT |
CTATGAACTTATGGACACTGAT |
|
MAPKKs |
RgMAPKK1 |
GTTATCTGATGGCTGAATTAAG |
TTCCTCCTCCTGATGAAG |
RgMAPKK2 |
CCTCCATCCATATACTCCA |
TCAATCAGTCATCTCAATCTC |
|
RgMAPKK3 |
CATACAATTAGCAAGTAACATCA |
CAAGTCCAAGTGTAAGTTCTA |
|
RgMAPKK4 |
GTGATAGAATGAGTGATAGCA |
AGATGAATATACAGGAGGAGAT |
|
RgMAPKK5 |
TTAACTGGACCTTCATTAGC |
TCGTAGGAACTGTCACAT |
|
RgMAPKK6 |
CCCTCCAATTTGCTGATTA |
CATATCCATCGTATTGTCCAT |
|
RgMAPKK7 |
CAAGCACACCTCTTCAAT |
CATACAGATGGCGATGTC |
|
MAPKKKs |
RgMAPKKK1 |
CCGTAACAGACCAATCAG |
AATACTGCCTCAACCTCT |
RgMAPKKK2 |
AGAGGTTGAGGCAGTATT |
TATCATCGGACGGTAAGG |
|
RgMAPKKK3 |
AGCATCCATTGTATGTATCC |
AGGTGACGGTAACGAATA |
|
RgMAPKKK4 |
TAATTCGGCTCCTCAGAA |
AACGGTGATGATGATGATAG |
|
RgMAPKKK5 |
ACGCTATCATCATCATCAC |
TGGAACTCTATCAGACGAA |
|
RgMAPKKK6 |
TGGAGGAGGATGAGATTAC |
CGGATAACATTGTCTGCTAT |
|
RgMAPKKK7 |
ATTTCACGGCGAAGATTT |
CACCTCACATACTTACATTCT |
|
RgMAPKKK8 |
ATTGCTTCATCTTCGGATT |
CACAGTCAACCAGTCTTC |
|
RgMAPKKK9 |
GCGAGTGACTTGAGAATT |
GAGCCTATGGTACAGTGA |
|
RgMAPKKK10 |
AGAGGAGGATTCGTTGAA |
TGTTCTCGTGGAGGTATT |
|
RgMAPKKK11 |
ATATTCTCTAAGCCTCCTGT |
TCAGCATTATGTCATCTCTATC |
|
RgMAPKKK12 |
TCGTCCTACCATCATACAA |
TCTCCTTCTTCTGCTTCA |
|
RgMAPKKK13 |
GACTTCACATCATTCAACTTAG |
GCTTATACAAGGCAGATTCTA |
|
RgMAPKKK14 |
GCATACACAAGGCAGATT |
TTCACAGAACCACTTACATC |
|
RgMAPKKK15 |
TCATCCTTCTTCACTCATTATC |
CACTGACCTACTACACATTC |
|
RgMAPKKK16 |
TGGCATCACATCCTTATTC |
TTCATACGAAGTTCACAAGAT |
|
RgMAPKKK17 |
TTGTCCGTCAATCTTATCATT |
GAGACTCCACCAATACCT |
|
RgMAPKKK18 |
TGGTCTGGCTTACTTACA |
TTGAAGGATAGCATTGAAGAA |
|
RgMAPKKK19 |
GGATAATGCGAGAACAATAAC |
CCGACAGAAGTATAAGATGG |
|
RgMAPKKK20 |
CTTCCACAGTATTGAACAATG |
AGTGAGAATGGGCAAATG |
|
RgMAPKKK21 |
TGCTAATGGACAAGTTAATGA |
TCAATGGAGAGGAAGGATT |
|
RgMAPKKK22 |
ACTTAGCATCGTCAGAGA |
ATCATATTCAACAGGAACATCT |
|
RgMAPKKK23 |
GAGGTGAAGAGGAGACAT |
GATTATGATATTGGCTGTAGGA |
|
RgMAPKKK24 |
GCAGAATCTTATGGATGGAA |
GCAGTATTATGGATCGGAAT |
|
RgMAPKKK25 |
TTTGAGAAGGATATTTGATGGA |
GTTGACATTATGCTACAGATTG |
|
RgMAPKKK26 |
TTGGATAATAGGAATGAGGATG |
GTCTGAATGGAGTAGTTGAG |
|
RgMAPKKK27 |
TTCTTGATTGGTCCTATGC |
ACTCCTCTGTATGTCTCTG |
|
RgMAPKKK28 |
GTTTATGTGATGATGATGTGTT |
AGTGATCCAATTATCTGATGTT |
|
RgMAPKKK29 |
ACATTCCTCCTCCTCAAA |
GCGAAGGGATTACACAAA |
|
RgMAPKKK30 |
GGCTCCTGAAGTTATTGTT |
AGATGCTCTGGTATTGGT |
|
RgMAPKKK31 |
GCTGGAGGAGGATATTCT |
TGGTACTGAAGGTGATGT |
|
RgMAPKKK32 |
AAGGAGCATCTTCTGATAATC |
GCCGACTGTTCATTAACT |
|
18S |
ATGATAACTCGACGGATCGC |
CTTGGATGTGGTAGCCGTTT |
family
proteins from TAIR10 database (https://www.arabidopsis.org),
which including 20 MAPKs, 10 MAPKKs and 80 MAPKKKs, respectively. A total of 1407 putative R. glutinosa
MAPK cascade family proteins were obtained by scanning with the homologous
sequences with protein library of R. glutinosa based on the constructed
model. After removing redundancies and annotating these putative protein
sequences using Blast2GO, we identified a total of 73 candidate R. glutinosa
MAPK cascade family proteins,
including 34 MAPKs (RgMAPK1~RgMAPK34), 7 MAPKKs (RgMAPKK1~RgMAPKK7) and 32 MAPKKKs
(RgMAPKKK1~ RgMAPKKK32), respectively. In addition, a series of parameters
including the sequence length, protein molecular weight, isoelectric point,
instability index and aliphatic index of R. glutinosa MAPK cascade family proteins were predicted
through ProtParam (https://web.expasy.org/protparam) (Table 2). For 34 RgMAPKs, the length ranged from 178 to
622 bp, and the molecular weight ranged from 20508.7 to 69862.2 Da. The
isoelectric point of the protein ranged from 5.04 to 9.27, and the instability
index ranged from 22.39 to 49.05. Instability indexes from 41.18% of RgMAPKs were greater than 40. The fat
index ranged from 77.60 to 102.52. For seven RgMAPKKs, which have the shortest and maximum length was 128 bp and
392 bp, respectively. The molecular weight ranged from 14557.9 to 43709.1Da.
Their protein isoelectric point (pI) ranged from 5.52 to 9.24. The instability
index ranged from 38.84 to 61.68, of which 5 RgMAPKKs (accounting for 71.43%) were greater than 40. The
aliphatic index ranged from 82.61 to 115.55. For 32 RgMAPKKKs, the sequence length ranged from 113 to 883 bp and the
Fig. 1: Construction of the phylogeny trees of the MAPK
cascade family proteins in R. glutinosa and Arabidopsis. (a) construction of the phylogeny tree
of MAPKs in the MAPK cascades of R. glutinosa and Arabidopsis; (b) construction of the phylogeny tree
of MAPKKs in the MAPK cascades of R. glutinosa and Arabidopsis; (c) construction of the phylogeny tree
of MAPKKKs in the MAPK cascades of R. glutinosa
molecular
weight ranged from 12967.5 to 95354.0Da. Their protein isoelectric point (pI)
ranged from 4.65 to 9.80. The instability index ranged from 37.41 to 74.86, of
which 28 RgMAPKKs (accounting for
87.5%) were greater than 40. The aliphatic indexes ranged from 56.02 to 96.36.
The construction of phylogenetic trees of R.
glutinosa MAPK cascades family proteins
MEGA 6.06
was used to construct the phylogenetic trees from the corresponding protein
sequences of the R. glutinosa and Arabidopsis MAPK cascade family
based on the Neighbor-Joining Tree model. The results indicated that both RgMAPKs and RgMAPKKs were divided into four subtypes, named as A, B, C and D,
respectively. RgMAPKKKs were divided
into three subtypes, named MEKK, RAF and ZIK (Fig. 1a–c). Meanwhile, most of
the R. glutinosa MAPK cascade family
proteins could match the corresponding proteins in Arabidopsis. For MAPK family (Fig. 1a), RgMAPK6, RgMAPK7, and RgMAPK8 from RgMAPKs and ATMK9 from Arabidopsis
MAPKs were grouped into one branch of
D subtype (Fig. 1a). RgMAPK1, RgMAPK2, RgMAPK3, RgMAPK4, and RgMAPK5 from RgMAPKs and ATPK17 from Arabidopsis
MAPKs were classified into another
branch of the D subtype (Fig. 1a). While RgMAPKK5
in RgMAPKKs and ATMAPKK3 in Arabidopsis MAPKKs were classified into the branch
of the B subtype (Fig. 1b), which confined the highly conserved features of the
MAPK cascade family proteins. The conservative features also supply a reference
for studying the biological function of the MAPK cascade family proteins.
Comparative
analysis of amino acid sequences of R. glutinosa MAPK cascade family
proteins
Multiple
sequence alignment of the amino acid sequences of 34 RgMAPKs and 20 Arabidopsis
MAPKs by ClustalX2.1 presented highly
similar amino acid motifs of these MAPKs
ranging from 270 to 440 aa. TDY or TEY structure ranging from 270 to 440 aa in
each MAPKs protein are conserved
motifs which was the specific
structure for recognizing the MAPKs
family. In addition, in the 421–430aa position, there was a CD domain defined as (LH)DXXDE(P)X, which was
found only in the C and D subtypes and excluded in the A and B subtypes of RgMAPKs (Fig. 2a). Meanwhile, the
conserved motifs of RgMAPKs predicted
by the MEME online tool indicated that most of the same subtypes of RgMAPKs had similarly conserved motifs
(Fig. 2b); especially, motif 2 presented this motif in all the subtype of RgMAPKs.
Multiple sequence alignment of the protein sequences of 7 RgMAPKKs and 10 Arabidopsis MAPKKs were
carried out using ClustalX 2.1 and a highly similar motif was found in the
sequence of these MAPKKs Table 2:
Analysis of physicochemical properties of R. glutinosa MAPK cascades
family proteins
Protein family |
Protein name |
Length (bp) |
MW (Da) |
pI |
Instability index |
Aliphatic index |
MAPKs |
RgMAPK1 |
484 |
55177.4 |
8.35 |
40.65 |
85.85 |
RgMAPK2 |
488 |
55686.9 |
8.19 |
41.08 |
86.54 |
|
RgMAPK3 |
372 |
43052.5 |
6.30 |
35.38 |
92.31 |
|
RgMAPK4 |
178 |
20508.7 |
6.79 |
22.39 |
99.16 |
|
RgMAPK5 |
254 |
29708.1 |
6.15 |
23.81 |
94.80 |
|
RgMAPK6 |
586 |
66925.8 |
6.41 |
40.22 |
77.87 |
|
RgMAPK7 |
571 |
65335.2 |
7.13 |
37.24 |
82.64 |
|
RgMAPK8 |
484 |
55734.6 |
8.09 |
37.16 |
87.25 |
|
RgMAPK9 |
190 |
22136.5 |
6.71 |
28.5 |
95.95 |
|
RgMAPK10 |
562 |
64269.8 |
9.07 |
38.55 |
80.75 |
|
RgMAPK11 |
470 |
54297.5 |
8.61 |
40.24 |
83.04 |
|
RgMAPK12 |
566 |
64782.3 |
8.93 |
40.17 |
77.60 |
|
RgMAPK13 |
598 |
68295.2 |
9.10 |
35.14 |
85.00 |
|
RgMAPK14 |
346 |
40257.6 |
9.22 |
33.21 |
89.65 |
|
RgMAPK15 |
213 |
25077.2 |
9.18 |
28.44 |
92.49 |
|
RgMAPK16 |
592 |
67579.6 |
9.27 |
48.05 |
81.55 |
|
RgMAPK17 |
607 |
68936.2 |
9.22 |
47.16 |
80.99 |
|
RgMAPK18 |
607 |
68176.4 |
9.21 |
45.94 |
84.05 |
|
RgMAPK19 |
607 |
68428.6 |
9.17 |
44.69 |
82.75 |
|
RgMAPK20 |
622 |
69862.2 |
9.09 |
45.54 |
82.17 |
|
RgMAPK21 |
369 |
42487.2 |
6.70 |
39.24 |
95.93 |
|
RgMAPK22 |
369 |
42431.1 |
6.54 |
40.89 |
95.66 |
|
RgMAPK23 |
369 |
42503.3 |
6.54 |
39.35 |
96.72 |
|
RgMAPK24 |
314 |
36191.9 |
6.33 |
49.05 |
102.52 |
|
RgMAPK25 |
370 |
42403.2 |
7.58 |
28.55 |
98.30 |
|
RgMAPK26 |
370 |
42375.2 |
7.56 |
29.43 |
98.30 |
|
RgMAPK27 |
383 |
43893.2 |
5.52 |
38.89 |
91.20 |
|
RgMAPK28 |
391 |
44965.5 |
5.55 |
41.68 |
91.10 |
|
RgMAPK29 |
190 |
21439.5 |
6.57 |
34.06 |
96.58 |
|
RgMAPK30 |
372 |
42792.1 |
5.60 |
37.58 |
92.07 |
|
RgMAPK31 |
316 |
36362.8 |
6.48 |
37.83 |
90.76 |
|
RgMAPK32 |
368 |
42192.2 |
5.04 |
47.76 |
94.59 |
|
RgMAPK33 |
376 |
43009.2 |
5.80 |
38.77 |
94.39 |
|
RgMAPK34 |
370 |
42447.4 |
6.50 |
39.05 |
91.16 |
|
MAPKKs |
RgMAPKK1 |
353 |
39093.8 |
5.59 |
42.20 |
97.00 |
RgMAPKK2 |
351 |
38790.4 |
5.60 |
39.60 |
94.42 |
|
RgMAPKK3 |
202 |
22710.0 |
5.48 |
47.94 |
91.58 |
|
RgMAPKK4 |
128 |
14557.9 |
6.34 |
38.84 |
115.55 |
|
RgMAPKK5 |
392 |
43709.1 |
5.52 |
46.52 |
90.84 |
|
RgMAPKK6 |
353 |
39164.7 |
9.24 |
61.68 |
82.61 |
|
RgMAPKK7 |
308 |
34559.8 |
8.01 |
57.89 |
85.78 |
|
MAPKKKs |
RgMAPKKK1 |
288 |
31838.3 |
5.71 |
49.01 |
79.24 |
RgMAPKKK2 |
341 |
37677.7 |
5.02 |
45.24 |
80.65 |
|
RgMAPKKK3 |
359 |
39881.2 |
5.24 |
46.85 |
78.22 |
|
RgMAPKKK4 |
363 |
40086.2 |
4.75 |
46.76 |
79.48 |
|
RgMAPKKK5 |
363 |
40181.4 |
4.80 |
46.60 |
80.55 |
|
RgMAPKKK6 |
395 |
43840.4 |
4.99 |
39.39 |
74.00 |
|
RgMAPKKK7 |
207 |
22633.5 |
5.83 |
48.56 |
81.11 |
|
RgMAPKKK8 |
351 |
38763.4 |
4.65 |
47.87 |
79.26 |
|
RgMAPKKK9 |
154 |
16230.5 |
6.82 |
39.10 |
96.36 |
|
RgMAPKKK10 |
285 |
31303.4 |
6.63 |
51.33 |
94.07 |
|
RgMAPKKK11 |
136 |
15025.5 |
9.41 |
51.23 |
75.22 |
|
RgMAPKKK12 |
581 |
65064.1 |
5.27 |
54.49 |
78.35 |
|
RgMAPKKK13 |
581 |
65041.0 |
5.22 |
53.37 |
78.52 |
|
RgMAPKKK14 |
621 |
68578.0 |
5.35 |
40.78 |
83.46 |
|
RgMAPKKK15 |
620 |
68447.8 |
5.22 |
41.12 |
83.29 |
|
RgMAPKKK16 |
678 |
75229.4 |
9.28 |
53.45 |
67.40 |
|
RgMAPKKK17 |
654 |
72265.1 |
8.92 |
68.17 |
74.59 |
|
RgMAPKKK18 |
629 |
68648.6 |
9.29 |
53.47 |
70.56 |
|
RgMAPKKK19 |
628 |
68181.0 |
9.28 |
53.70 |
69.44 |
|
RgMAPKKK20 |
120 |
13088.8 |
8.42 |
56.56 |
82.83 |
|
RgMAPKKK21 |
230 |
25230.5 |
9.35 |
37.57 |
78.00 |
|
RgMAPKKK22 |
215 |
23766.9 |
9.39 |
49.73 |
73.95 |
|
RgMAPKKK23 |
883 |
95354.0 |
9.54 |
71.01 |
66.75 |
|
RgMAPKKK24 |
533 |
57099.5 |
9.73 |
74.86 |
56.02 |
|
RgMAPKKK25 |
166 |
18722.5 |
9.34 |
46.67 |
78.13 |
|
RgMAPKKK26 |
190 |
21093.4 |
8.85 |
45.22 |
92.79 |
|
RgMAPKKK27 |
151 |
17681.9 |
5.44 |
37.41 |
75.43 |
|
RgMAPKKK28 |
275 |
30370.3 |
5.22 |
45.50 |
76.55 |
|
RgMAPKKK29 |
113 |
12967.5 |
4.75 |
63.35 |
83.72 |
|
RgMAPKKK30 |
423 |
46975.4 |
5.33 |
56.31 |
65.22 |
|
RgMAPKKK31 |
624 |
67777.4 |
9.49 |
57.75 |
70.98 |
|
RgMAPKKK32 |
316 |
34775.5 |
9.80 |
60.91 |
81.80 |
MW:
molecular weight; pI: isoelectric point
ranging from 200 to 260 aa. For example, conserved residual active sites D (L/I/V) K of lysine (K) and
aspartic acid (D) were presented in each sequence at positions 218–220 aa. At
the same time, there was a highly conserved phosphorylation target site domain
S/T-X5-S/T of the MAPKKs at positions
246–252aa (Fig. 3a). In addition, the conserved motifs of RgMAPKKs were analyzed by the MEME online tool and similar motifs
were found in the same subtype (Fig. 3b).
The physiological
response of R. glutinosa under consecutive monoculture stress
To
determine the effects of consecutive monoculture stress on R. glutinosa,
the physiological indexes in the roots of FP and SP R. glutinosa were
assessed (Fig. 4). The results showed that catalase activity in SP R.
glutinosa was significantly higher than that of FP R. glutinosa from
40 DAP. At the same time, this significant difference persists during
subsequent growth. Moreover, superoxide dismutase, peroxidase, hydrogen
peroxide, and malondialdehyde showed the significant differences from 60 DAP.
Among them, the activity of superoxide dismutase and peroxidase showed an
increasing trend in FP R. glutinosa, while the hydrogen peroxide and
malondialdehyde content showed a decreasing trend. However, the root activity
showed a significant difference between FP and SP R. glutinosa after 80
DAP. These findings indicated that the antioxidant enzyme system of SP R.
glutinosa was triggered to eliminate the oxidative damage caused by replant
disease. However, finally, with increasing of replant disease level, SP R.
glutinosa encountered the serious stress, leading to root vitality decline
was still unavoidable.
Differential
expression pattern of R. glutinosa MAPK cascade family genes under
consecutive monoculture stress
To explore the expression pattern of R. glutinosa
MAPK cascade family genes in process of consecutive monoculture stress, qRT-PCR
was used to measure the expression of the genes at different growth stages (40,
60, 80, 100, and 120 DAP). The results showed that there were significant
differences in expression between FP and SP R. glutinosa at key growth stages for MAPK
cascade family genes. According to expression differences between the FP and SP
R. glutinosa at 40, 60, and 80 DAP, a set of 34 RgMAPKs could be
roughly divided into three categories, among which 20 RgMAPKs have
higher expression in SP than FP. Of the 20 RgMAPKs up-regulated in
replanted R. glutinosa, 2 (RgMAPK2 and RgMAPK15) were
significantly up-regulated at the 40 DAP and 15 genes were significantly
up-regulated at the 60 DAP. One (RgMAPK26) showed significant
up-regulation at the 80 DAP, while the other two RgMAPKs (RgMAPK18
and RgMAPK23) were significantly down-regulated at the 40 DAP and significantly
up-regulated at the 60 and 80 DAP (Fig. 5a). Among the seven RgMAPKs
down-regulated in replanted R. glutinosa, except for RgMAPK28 and
RgMAPK34, the other five indicated a
down-regulated trend in whole growth process of FP and SP R. glutinosa
(Fig. 5b). At the same time, the RgMAPKs showed down-regulated
expression in replanted R. glutinosa, which were also prominently
expressed from 40 DAP to 60 DAP. In addition, RgMAPK30 in the whole
reproductive process of SP R. glutinosa showed a significant
down-regulated trend compared with FP. There were no significant expression differences among the
seven RgMAPKs, except for RgMAPK21, the other six showed almost
the same expression trend in FP and SP R. glutinosa (Fig. 5c).
Fig. 4: The contents of physiological indexes in the FP and SP R.
glutinosa roots. (a) The first
planted R. glutinosa; (b) the
morphological characteristics of the FP R. glutinosa; (c) the second planted R. glutinosa;
(d) the morphological
characteristics of the SP R. glutinosa; (e) the contents of physiological
indexes. FP: first planting; SP: second planting. *indicates significant
differences (P < 0.05; t test),
and**indicate significant differences (P
< 0.01; t test)
Among the seven RgMAPKKs identified in this
study, two were up-regulated during formation of replanted disease compared
with the FP R. glutinosa, and five showed a down-regulated expression
trend (Fig. 6). For example, the expression of RgMAPKK1 and RgMAPKK5
at the 40, 60, and 80 DAP of the SP R. glutinosa were higher than those
of the FP and reached a significant and extremely significant degree at the 40
and 80 DAP, respectively. The down-regulated five RgMAPKKs in SP and FP R.
glutinosa, reached significant or extremely significant differences at the
whole growth stages. For example, RgMAPKK2, RgMAPKK4, and RgMAPKK7
indicated significant differences at the 40 DAP, while RgMAPKK3 and RgMAPKK6
showed significant differences at the 60 DAP. In addition, compared to the FP,
the expression of RgMAPKK4 in the whole growth process of the SP R.
glutinosa showed a trend of down-regulation trend and reached the
significant or extremely significant differences at the 40 and 100 DAP,
respectively.
According to the expression pattern of MAPKKKs in
the FP and SP at the 40, 60 and 80 DAP, a set of 32 RgMAPKKKs could be
roughly divided into three categories, of which the expression of 8 RgMAPKKKs
were significantly higher in the SP R. glutinosa than that in the FP, 16
RgMAPKKKs were significantly lower in the SP R. glutinosa than
that in the FP, and eight RgMAPKKKs showed no significant difference
(Fig. 7). Among the eight RgMAPKKKs up-regulated in the SP R.
glutinosa, four RgMAPKKKs (RgMAPKKK2, RgMAPKKK17, RgMAPKKK18
and RgMAPKKK30) were significantly up-regulated at the 40 DAP and RgMAPKKK15
and RgMAPKKK12 were significantly up-regulated from the 60 DAP and 100
DAP, respectively. RgMAPKKK5 and RgMAPKKK11 were significantly
down-regulated at the 40 DAP and significantly up-regulated at the 60 and 80
DAP (Fig. 7a). Sixteen RgMAPKKKs downregulated in FP R. glutinosa,
were sharply expressed at the 80 DAP. There were also some genes, such as RgMAPKKK3,
RgMAPKKK4 and RgMAPKKK20, which shown differentially expressed
covering almost the entire reproductive process of R. glutinosa (Fig. 7b).
Discussion
According to statistics, more than 70% of roots and
rhizomes herbs have consecutive monoculture problems, which seriously restrict
the development of modern Chinese medicine agriculture (Huang et al.
2013; Zhang et al. 2013; Chen et al. 2016). Preliminary studies
indicated that the immune system abnormalities of R. glutinosa may be
the initial characterization of the consecutive monoculture problem obstacles
(Chen et al. 2018, 2019; Xie et al. 2019).
Fig. 5:
Validation of expression of the RgMAPKs at different growth stages of FP
and SP R. glutinosa using qRT-PCR. (a),
(b) and (c) represent three different types of expression trends. FP: first
planting; SP: second planting. The 120 days after planting (DAP) of SP was used
as the reference to obtain the expression of different periods, and 2-△Ct was used as
the relative expression of each gene. * indicates significant differences (P < 0.05; t test), and ** indicate
significant differences (P < 0.01;
t test)
However, MAPKs have been widely recognized as the
major protein phosphorylation cascade involved in signal transduction and gene
regulation in plants (Tena et al. 2001; Lindemose et al. 2013).
Therefore, the recognition of the expression pattern of MAPK cascade family
proteins and its encoding genes responding to replanted R. glutinosa
becomes a key to comprehend the signal transduction of its immune system
abnormalities. In this study, the protein sequences of 34 RgMAPKs, 7 RgMAPKKs and
32 RgMAPKKKs in the MAPK cascades of R.
glutinosa
Fig. 6: Validation of expression of the RgMAPKKs at different growth
stages of FP and SP R. glutinosa using qRT-PCR. FP: first planting; SP:
second planting. The 120 days after planting (DAP) of SP was used as the
reference to obtain the expression of different periods, and 2-△Ct was used as the relative expression of each gene. *
indicate significant differences (P
< 0.05; t test), and ** indicates significant differences (P < 0.01; t test)
were
initially identified, which provided a data-based foundation for studying the
molecular mechanism of R. glutinosa MAPK cascades responding to
consecutive monoculture stress.
By sequence alignment and motif analysis of the R.
glutinosa MAPK cascade family proteins, we found that these protein
sequences were highly similar and conserved with the homologue sequences in Arabidopsis,
offering a possibility to explore the "perception" and
"receiving" pathways for consecutive monoculture problem obstacle
signals. For example, at the 274–276 aa of the R. glutinosa MAPKs protein sequence, the conserved
motifs TDY and TEY of MAPKs were
found, which was an essential condition to accurately identify the R.
glutinosa MAPKs cascade family
protein members. In addition, at the 421–430 aa of MAPKs, there was a CD domain defined as (LH)DXXDE(P)X (Fig. 2a),
which might be an action site of MAPKKs.
It had been shown that the adjacent acidic residues D (aspartate) and E
(glutamate) played an important role in the interaction of the K (lysine) and R
in MAPKKs (Tanoue et al.
2000). However, this CD domain only existed in the C and D subtypes of MAPKs, exclusive from the A and B
subtypes (Fig. 2a), which was consistent with the research in Brachypodium
distachyon (Chen et al. 2012). For another example, a highly
conserved phosphorylation target site domain S/T-X5-S/T was found at the
246–252 aa of RgMAPKKs, which worked as the recognition site in the
activation of the MAPK cascade and was published on other plants, such as Arabidopsis
(Chen et al. 2012; Liang et al. 2013). In addition, the reason
why the individual MAPK cascade pathway protein sequence differs greatly from
the conserved domain of the same subtype may be that the protein sequence was
not full length and failed to render its conserved domain.
The expression pattern of all of the obtained MAPK
cascade proteins was verified by qRT-PCR. The results revealed that a large
number of MAPK cascades family genes significantly differentially expressed in
the SP and FP R. glutinosa. It is speculated that the effect of
consecutive monoculture on the reproductive process of R. glutinosa was
multifaceted and the MAPK cascade was widely involved. Overall, the
differential expression of MAPKs, MAPKKs, and MAPKKKs in
FP and SP R. glutinosa mainly occurred at the 40, 60 and 80 DAP, which
is consistent with the physiological response result (Fig. 4). At the same
time, according to the differential expression of these encoding genes at the
three key stages, 34 RgMAPKs and 32 RgMAPKKKs can be divided into
three categories: up-regulation, down-regulation, and no significant
differential expression (Fig. 5 and 7). The seven down-regulated RgMAPKs
genes, except RgMAPK28 and RgMAPK34, showed a downward trend in
both FP and SP R. glutinosa, indicating that these genes play a negative
regulatory role. However, the expression of these genes showed a significant downward
trend in the SP R. glutinosa. We speculated that the consecutive
monoculture induced the down-regulation of these genes, accelerating the whole
reproductive process of SP R. glutinosa and leading to premature senescence and even death (Yang et al. 2015). In addition, the expression of
seven RgMAPKKs was significantly different in the key reproductive
processes of FP and SP R.
glutinosa (Fig. 6). However, the fertility stages at which these genes
significant differentially expressed were found to be inconsistent in FP and SP
R. glutinosa. Some individual genes even significant differentially
expressed at other growth stages except these three critical periods,
indicating that the same gene plays different functions at different growth and
development stages.
With the
whole genome sequencing of some plants, a large number of genes and proteins
involved in the MAPK cascades pathway were identified and described in some
model plants. For example, the first confirmed cascade was the
MEKK1-MKK4/5-MPK3/6 cascade in Arabidopsis, which played an important
role in plant natural immunity (Asai et al. 2002; Galletti et al.
2011). The MEKK1-MKK2-MPK4 and YDA-MKK4/5-MPK3/6 cascade pathways response to
low temperature stress and regulation of stomatal development in Arabidopsis,
respectively (Eckardt 2007; Furuya et al. 2014). The
NPK1-NQK1/NtMEK1-NRK1 cascade regulates cytokinesis during meiosis and mitosis
(Soyano et al. 2003). This study can provide new ideas and possibilities
for revealing the mechanism of the consecutive monoculture problem based on
revealing the response
Fig. 7: Validation of expression of the RgMAPKKKs at different growth
stages of FP and SP R. glutinosa using qRT-PCR. (a), (b) and (c) represent three different types of
expression trends. FP: first planting; SP: second planting. The 120 days
after planting (DAP) of SP was used as the reference to obtain the expression
of different periods, and 2-△Ct was used as the relative expression of each gene. * indicates
significant differences (P < 0.05;
t test), and ** indicates significant differences (P < 0.01; t test)
and transmission of the MAPK cascade to consecutive
monoculture stress. Combined with the research of MAPK cascades in other
plants, the MAPKKs family genes are significantly less than the MAPKs
and MAPKKKs family genes. For example, 20 MAPKs, 10 MAPKKs,
and 80 MAPKKKs have been found in the Arabidopsis genome (Jonak et
al. 2002; Colcombet and Hirt 2008), while 17 MAPKs, 8 MAPKKs,
and 75 MAPKKKs have been found in the rice genome (Rohila and Yang 2007;
Rao et al. 2010; Wankhede et al. 2013). Sixteen possible MAPKs,
6 MAPKKs, and 89 MAPKKKs have been found in the tomato genome
(Kong et al. 2012; Wu et al. 2014) and at least 14 MAPKs,
6 MAPKKs, and 59 MAPKKKs have been found in the cucumber genome
(Wang et al. 2015). It is hypothesized that the MAPK cascade should resemble a dumbbell-shaped structure for
signal reception and transmission, and the MAPKKs family genes may play
a central regulatory role. Therefore, with the in-depth study of the small
number of sites and specific locations of the MAPKKs family genes, this
study may become a breakthrough to reveal
the MAPK cascade of R. glutinosa.
In this
study we identified the R. glutinosa MAPK cascade family proteins and
obtained protein sequences of 34 RgMAPKs,
7 RgMAPKKs, and 32 RgMAPKKKs, respectively. By comparing
MAPK cascade protein sequences and analyzing the differential expression pattern
of the coding gene in the FP and SP R. glutinosa, we initially screened
some candidate MAPK cascades family genes that may respond to consecutive
monoculture stress (27 RgMAPKs, 7 RgMAPKKs, and 24 RgMAPKKKs),
providing a general understanding of the R. glutinosa MAPK cascades
response to consecutive monoculture stress. In addition, this research
complements a new chain of evidence for interpreting the mechanism signal
transduction of R. glutinosa under
consecutive monoculture stress. Finally, the differential expressed genes in
this study could be potential target genes for genetic improvement of R.
glutinous under consecutive monoculture stress.
Conclusion
In this
study, the MAPK cascade family proteins of R. glutinosa were recognized
and identified for the first time, and qRT-PCR was used to quantity-analyze the
expression patterns of all of the acquired MAPK cascade proteins at the five
growth stages between FP R. glutinosa and SP. The MAPK cascades were
widely involved in signal transduction, gene regulation and highly conserved
characteristics, providing a new way to interpret the immune mechanism of R.
glutinosa responding to consecutive monoculture stress and adding an
important data-based foundation and theoretical basis for consummating the
mechanism of the replanted obstacles of R. glutinosa.
Acknowledgements
The
research was financially supported by the National Natural Science Foundation
of China (Nos. 81603243 and 81573538) and National Key Research and Development
Program of China (No. 2017YFC700705).
References
Asai T, G Tena, J
Plotnikova, MR Willmann, WL Chiu, L Gomez-Gomez, T Boller, FM Ausubel, J
Sheen (2002). MAP kinase signaling cascade in Arabidopsis innate immunity. Nature
415:977‒983
Chen A, L Gu, N Xu, F Feng, D Chen, C
Yang, B Zhang, M Li, Z Zhang (2019). NB-LRRs not responding consecutively to Fusarium
oxysporum proliferation caused replant disease formation of Rehmannia
glutinosa. Intl J Mol Sci 20:3203–3223
Chen A, L Gu, M Li, N Xu, F Feng, G Liu, B
Zhang, D Gong, J Zhang, H Liu, Z Zhang (2018). Identification of Rehmannia
glutinosa L. NB-ARC family proteins and their typical changes under
consecutive monoculture stress. Acta Physiol Plantarum 40:95–108
Chen A, M Li, B Zhang, F Wang, L Gu, F
Feng, H Liu, Z Zhang (2016). Review on catastrophe mechanism of medicinal plant
and its rhizosphere microecosystem mediated by consecutive monoculture. Modern
Chin Med 18:239‒245
Chen
L, W Hu, S Tan, M Wang, Z Ma, S Zhou, X Deng, Y Zhang, C Huang, G Yang, G He (2012).
Genome-wide identification and analysis of MAPK
and MAPKK gene families in Brachypodium
distachyon. PLoS One 7; Article e46744
Colcombet J, H Hirt (2008). Arabidopsis MAPKs: A complex signalling network involved in multiple biological
processes. Biochem J 413:217‒226
Eckardt NA (2007). A complete MAPK signaling cascade that functions in stomatal
development
and
patterning
in Arabidopsis. Plant Cell 19:7–8
Fan HM, MJ Li, ZY Zhang, YH Yang, L Gu, FQ
Wang, XJ Chen, ZY Zhang (2012). Spatiotemporal expression and analysis of
responding consecutive monoculture genes in Rehmannia glutinosa. Chin
J Chin Mater Med 37:3029‒3035
Furuya
T, D Matsuoka, T Nanmori (2014). Membrane rigidification functions upstream of
the MEKK1-MKK2-MPK4 cascade during cold acclimation in Arabidopsis thaliana. FEBS Lett 588:2025‒2030
Galletti R, S Ferrari, GD Lorenzo (2011).
Arabidopsis MPK3 and MPK6 play different roles in basal and oligogalacturonide-or
flagellin-induced resistance against Botrytis cinerea. Plant Physiol
157:804‒814
Gu L, W Zheng, M Li, H Quan, J Wang, F Wang, W
Huang, Y Wu, X Lan, Z Zhang (2018). Integrated analysis of transcriptomic and
proteomics data reveals the induction effects of rotenoid biosynthesis of Mirabilis himalaica caused by UV-B
radiation. Intl J Mol Sci 19:3324–3343
Gu L, MM Niu, HY Zheng, JM Wang, LK Wu, ZF
Li, ZY Zhang (2013). Effect of continuous cropping of Rehmannia on its
morphological and physiological characteristics. J Chin Med Mater 36:691‒695
Huang LF, LX Song, XJ Xia, WH Mao, K Shi,
YH Zhou, JQ Yu (2013). Plant-soil feedbacks and soil sickness: From mechanisms
to application in agriculture. J Chem Ecol 39:232‒242
Jiménez C, BR Cossío, CJ Rivard, T Berl,
JM Capasso (2007). Cell division in the unicellular microalga Dunaliella viridis depends on
phosphorylation of extracellular signal-regulated kinases (ERKs). J Exp Bot 58:1001‒1011
Jonak C, L Ökrész, L Bögre, H Hirt (2002).
Complexity, cross talk and integration of plant MAP kinase signalling. Curr Opin
Plant Biol 5:415‒424
Kong F, J Wang, L Cheng, S Liu, J Wu, Z
Peng, G Lu (2012). Genome-wide analysis of the mitogen-activated protein kinase
gene family in Solanum lycopersicum. Gene
499:108‒120
Li M, Y Yang, F Feng, B Zhang, S Chen, C
Yang, L Gu, F Wang, J Zhang, A Chen, W Lin, X Chen, Z Zhang (2017).
Differential proteomic analysis of replanted Rehmannia glutinosa roots by iTRAQ reveals molecular mechanisms for
formation of replant disease. BMC Plant Biol 17; Article 116
Li ZF, CL He, Y Wang, MJ Li, YJ Dai, T
Wang, WX Lin (2016). Enhancement of trichothecene mycotoxins of Fusarium
oxysporum by ferulic acid aggravates oxidative damage in Rehmannia
glutinosa Libosch. Sci Rep 6; Article 33962
Liang
W, B Yang, BJ Yu, Z Zhou, C Li, M Jia, Y Sun, Y Zhang, F Wu, H Zhang, B Wang,
MK Deyholos, YQ Jiang (2013). Identification and analysis of MKK and MPK gene families in canola (Brassica napus L.). BMC
Genomics 14; Article 392
Lindemose
S, C O'Shea, MK Jensen, K Skriver (2013). Structure, function and networks of
transcription factors involved in abiotic stress responses. Intl J Mol Sci 14:5842‒5878
Pitzschke A, A Schikora, H Hirt (2009).
MAPK cascade signalling networks in plant defence. Curr Opin Plant Biol
12:421‒426
Rao KP, T Richa, K Kumar, B Raghuram, AK
Sinha (2010). In silico analysis reveals 75 members of mitogen-activated
protein kinase kinase kinase gene family in rice. DNA Res 17:139‒153
Rohila JS, Y Yang (2007). Rice
mitogen-activated protein kinase gene family and its role in biotic and abiotic
stress response. J Integr Plant Biol 49:751‒759
Soyano T, R Nishihama, K Morikiyo, M Ishikawa,
Y Machida (2003). NQK1/NtMEK1 is a MAPKK
that acts in the NPK1 MAPKKK-mediated
MAPK cascade and is required for plant cytokinesis. Gene Dev 17:1055‒1067
Suarez LC, RR Fernandez (2010). Signalling
pathway in plants affected by salinity and drought. Inform Técn Econ
Agrar 106:157‒169
Tanoue T, M Adachi, T Moriguchi, E Nishida
(2000). A conserved docking motif in MAP
kinases common to substrates, activators and regulators. Nat Cell Biol
2:110‒116
Tena G, T Asai, WL Chiu, J Sheen (2001).
Plant mitogen-activated protein kinase signaling cascades. Curr Opin Plant
Biol 4:392‒400
Tian
YH, FJ Feng, B Zhang, MJ Li, FQ Wang, L Gu, AG Chen, ZJ Li, WB Shan, XR Wang,
XJ Chen, ZY Zhang (2017). Transcriptome analysis reveals metabolic alteration
due to consecutive monoculture and abiotic stress stimuli in Rehamannia
glutinosa Libosch. Plant Cell Rep 36:859‒875
Wang
HB, M Gong, JY Guo, H Xin, Y Gao, C Liu, DQ Dai, LZ Tang (2018). Genome-wide identification
of Jatropha curcas MAPK, MAPKK, and MAPKKK gene families and their expression profile under cold stress.
Sci Rep 8; Article 16163
Wang J, C Pan, Y Wang, L Ye, J Wu, L Chen,
T Zou, G Lu (2015). Genome-wide identification of MAPK, MAPKK, and MAPKKK gene families and transcriptional
profiling analysis during development and stress response in cucumber. BMC
Genomics 16; Article 386
Wankhede
DP, M Misra, P Singh, AK Sinha (2013). Rice mitogen activated protein kinase kinase
and mitogen activated protein kinase interaction network revealed by in-silico docking and yeast two-hybrid
approaches. PLoS One 8; Article e65011
Wu J, J Wang, C Pan, X Guan, Y Wang, S
Liu, Y He, J Chen, L Chen, G Lu (2014). Genome-wide identification of MAPKK and MAPKKK gene families in tomato and transcriptional profiling
analysis during development and stress response. PLoS One 9; Article
e103032
Xie ZM, CY Yang, AG Chen, MJ Li, L Gu, JY
Zhang, FJ Feng, B Zhang, SQ Chen, ZY Zhang (2019). Identification and
expression analysis of leucine-rich repeat receptor-like kinase family reveals
the roles of resistance proteins during formation of replant disease in Rehmannia
glutinosa Libosch. Intl J Agric Biol 22:487‒496
Xu J, SQ Zhang (2015). Mitogen-activated
protein kinase cascades in signaling plant growth and development. Trends
Plant Sci 20:56‒64
Yang
YH, MJ Li, XY Li, XJ Chen, WX Lin, ZY Zhang (2015). Transcriptome-wide
identification of the genes responding to replanting disease in Rehmannia
glutinosa L. roots. Mol Biol Rep 42:881‒892
Zhang B, XZ Li, FQ Wang, MJ Li, JY Zhang,
Li Gu, LJ Zhang, WQ Tu, ZY Zhang (2016). Assaying the potential autotoxins and
microbial community associated with Rehmannia glutinosa replant problems
based on its ‘autotoxic circle’. Plant Soil 407:307‒322
Zhang
ZY, MJ Li, XJ Chen, LK Wu, J Li, FQ Wang, ZF Li, GY Guo, WX Lin (2013).
Research advancement and control strategy of consecutive monoculture problem
of Rehmannia glutinosa.
Mod Chin Med 15:38‒44
Zhang ZY, H Chen, YH Yang, T Chen, RY Lin,
XJ Chen, WX Lin (2010). Effects of continuous cropping on bacterial community
diversity in rhizosphere soil of Rehmannia glutinosa. Chin J Appl
Ecol 21:2843‒2848